Compound Compound Repeats of Silene conica mitochondrion chromosome 23
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_016225 | (CT)8tgctttcttcttgacttctttgctttcttttttgtaaataaaaagatcatattaattgtattaattgctcctctttttgc(ATTA)3 | c | 394 | 501 | 108 | Design Primer |
| 2 | NC_016225 | (ATTA)3atattaattaattgtattaattaattgtattaattgctcctctttttgc(ATTA)3 | c | 79451 | 79523 | 73 | Design Primer |
| 3 | NC_016225 | (AAAG)3tcacaaagagagcaaaaaggcagaaaaagc(AAAG)3 | c | 80488 | 80541 | 54 | Design Primer |