Compound Compound Repeats of Ptychoptera sp. ATB-2011 mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_016201 | (TTAT)3gtaacatctttagcgtctaatgaaatattctctttttctattaaaacttatt(TAA)4 | c | 10082 | 10157 | 76 | Design Primer |
2 | NC_016201 | (TAAA)3aaaaaataaatatt(AATA)3 | c | 13938 | 13975 | 38 | Design Primer |
3 | NC_016201 | (T)11atataattatttaaaattaattttgcatttattaaaatcaataatatatacc(AT)9 | c | 15002 | 15082 | 81 | Design Primer |