All Repeats of Baylisascaris procyonis mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_016200 | (T)11 | p1 | 1181 | 1191 | 11 | Design Primer |
| 2 | NC_016200 | (TA)16tt(TA)8 | c | 1432 | 1481 | 50 | Design Primer |
| 3 | NC_016200 | (TA)8ct(TA)8 | c | 1889 | 1922 | 34 | Design Primer |
| 4 | NC_016200 | (TA)6attatatataattatatataattattctaattatttat(TA)21t(TA)6tttatatgtatataattagatatgtatatgtataa(AT)9 | c | 2091 | 2248 | 158 | Design Primer |
| 5 | NC_016200 | (TA)6a(AT)6 | c | 2376 | 2400 | 25 | Design Primer |
| 6 | NC_016200 | (T)10 | p1 | 2945 | 2954 | 10 | Design Primer |
| 7 | NC_016200 | (TTTG)3 | p4 | 4387 | 4398 | 12 | Design Primer |
| 8 | NC_016200 | (T)10gaaccagttttg(T)12 | c | 7394 | 7427 | 34 | Design Primer |
| 9 | NC_016200 | (TATT)3 | p4 | 8468 | 8479 | 12 | Design Primer |
| 10 | NC_016200 | (GTTT)3 | p4 | 9278 | 9289 | 12 | Design Primer |
| 11 | NC_016200 | (TTTTTG)3 | p6 | 12635 | 12652 | 18 | Design Primer |
| 12 | NC_016200 | (T)10ctaatttttttatgggtatttttgcttgtatg(T)10 | c | 13643 | 13694 | 52 | Design Primer |
| 13 | NC_016200 | (T)11 | p1 | 14159 | 14169 | 11 | Design Primer |
| 14 | NC_016200 | (T)10 | p1 | 14612 | 14621 | 10 | Design Primer |