Compound Compound Repeats of Kallima inachus mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_016196 | (AAT)4aaataaaaaattaatattc(A)10tc(TAAA)3 | c | 6298 | 6352 | 55 | Design Primer |
| 2 | NC_016196 | (AT)6tataatttaatattattaaatatattatt(A)13 | c | 9551 | 9604 | 54 | Design Primer |
| 3 | NC_016196 | (AAATT)3aaaatttcacttaataatttaatatttattttaataattaattatttattataaactgaaa(TAATT)3 | c | 14526 | 14616 | 91 | Design Primer |