Compound Compound Repeats of Onchocerca flexuosa mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_016172 | (T)20gattg(T)12 | c | 4263 | 4299 | 37 | Design Primer |
2 | NC_016172 | (T)11gagtctgttttatttttttattttttgtgttttggtttgatttctggagtagctggtttggtta(T)10 | c | 7206 | 7290 | 85 | Design Primer |
3 | NC_016172 | (T)10ggtttgtttcgtttgttttc(T)14 | c | 13553 | 13596 | 44 | Design Primer |