Compound Compound Repeats of Candida galli mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_016116 | (TA)6tgtttatgaattaaacctg(TA)6 | c | 22275 | 22317 | 43 | Design Primer |
| 2 | NC_016116 | (AAT)4ataatatctaatatccaataataataaatttttgtatattaagatatatatcttttata(TAT)4 | c | 29044 | 29126 | 83 | Design Primer |
| 3 | NC_016116 | (AT)10acaaa(AT)7acaaaa(AT)9 | c | 30577 | 30639 | 63 | Design Primer |