Compound Compound Repeats of Picea morrisonicola chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_016069 | (A)10c(T)11 | c | 9737 | 9758 | 22 | Design Primer |
| 2 | NC_016069 | (TA)6tgcatatatatttatacatctattgatactcctccgctccgtatgtcccat(A)12ga(CCAT)3 | c | 49795 | 49883 | 89 | Design Primer |
| 3 | NC_016069 | (A)13(G)10 | c | 91110 | 91132 | 23 | Design Primer |