Compound Compound Repeats of Stenopirates sp. HL-2011 mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_016017 | (A)10tata(AAAT)3 | c | 6399 | 6424 | 26 | Design Primer |
2 | NC_016017 | (TCTT)5(TC)31(TA)11 | c | 11439 | 11542 | 104 | Design Primer |
3 | NC_016017 | (A)11tattttttttaacttaaaattactaaaaaaaataattaattttataaattta(AATTG)3 | c | 12729 | 12806 | 78 | Design Primer |