Compound Compound Repeats of Coloceras sp. SLC-2011 mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_015997 | (T)15ggttttttttccttattggtttt(A)10 | c | 4101 | 4148 | 48 | Design Primer |
2 | NC_015997 | (T)10ctttgatttgtttaaatacttatctggggctttaatgaaaattttgtttactaatccatttgtttttgttaaaatgtgttgttgaaatgggaatagtc(T)11 | c | 7161 | 7279 | 119 | Design Primer |
3 | NC_015997 | (T)10c(T)10 | c | 7645 | 7665 | 21 | Design Primer |
4 | NC_015997 | (T)10gttcccatattgtttgggttttggtctttagggtcagtagtttctagattgaagtattttgtagtccagtcgattggatcttcga(T)10 | c | 11842 | 11946 | 105 | Design Primer |