Compound Repeats of Marssonina brunnea f. sp. 'multigermtubi' mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_015991 | (T)14att(A)10 | c | 1946 | 1972 | 27 | Design Primer |
2 | NC_015991 | (A)11gaaaacctgatattattaatttagtacaaataaaggcgat(A)10 | c | 12277 | 12337 | 61 | Design Primer |
3 | NC_015991 | (ACAA)3(TAAA)3attagcattctatgttaaccgtttca(T)10 | c | 23715 | 23774 | 60 | Design Primer |
4 | NC_015991 | (A)10catattagat(A)10 | c | 59018 | 59047 | 30 | Design Primer |