Compound Repeats of Baylisascaris schroederi mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_015927 | (TA)12at(TA)13 | c | 1730 | 1781 | 52 | Design Primer |
| 2 | NC_015927 | (TA)18aatatacgtatcaaaatgtatatatatgtatatatatacattttgatgcgtatagaatatacaaacaaatttaaaatagtaatg(TA)6a(AT)6 | c | 2282 | 2426 | 145 | Design Primer |
| 3 | NC_015927 | (T)10gatccggttttg(T)12 | c | 7402 | 7435 | 34 | Design Primer |
| 4 | NC_015927 | (T)10ctaatttttttatgagggtttttgcttgtg(T)12 | c | 13637 | 13688 | 52 | Design Primer |