Compound Repeats of Olea europaea subsp. maroccana chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_015623 | (AG)6aattgtcaaaatggatagagtacctcttatgttatctac(T)11 | c | 4639 | 4700 | 62 | Design Primer |
2 | NC_015623 | (C)11(T)10c(A)15 | c | 17441 | 17477 | 37 | Design Primer |
3 | NC_015623 | (C)10(A)10ttttctcggttatgagacacattacaatttaatataagtccccaaaataaaatg(A)10 | c | 37950 | 38033 | 84 | Design Primer |
4 | NC_015623 | (GAAA)3ttta(T)13 | c | 63015 | 63043 | 29 | Design Primer |