All Repeats of Libelloides macaronius mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_015609 | (ATCA)3 | p4 | 798 | 809 | 12 | Design Primer |
2 | NC_015609 | (AATA)3 | p4 | 9066 | 9077 | 12 | Design Primer |
3 | NC_015609 | (A)10 | p1 | 9610 | 9619 | 10 | Design Primer |
4 | NC_015609 | (A)10 | p1 | 11827 | 11836 | 10 | Design Primer |
5 | NC_015609 | (AAAT)4 | p4 | 12054 | 12069 | 16 | Design Primer |
6 | NC_015609 | (AAAT)3 | p4 | 13632 | 13643 | 12 | Design Primer |
7 | NC_015609 | (A)10 | p1 | 15075 | 15084 | 10 | Design Primer |
8 | NC_015609 | (A)11tttctacatgcgatttttgt(A)10 | c | 15331 | 15371 | 41 | Design Primer |