Compound Repeats of Olea europaea subsp. cuspidata chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_015604 | (AG)6aattgtcaaaatggatagagtacctcttatgttatctac(T)12 | c | 4639 | 4701 | 63 | Design Primer |
| 2 | NC_015604 | (C)10(T)10c(A)13 | c | 17440 | 17473 | 34 | Design Primer |
| 3 | NC_015604 | (GAAA)3tttc(T)12 | c | 63000 | 63027 | 28 | Design Primer |