Compound Repeats of Olea europaea subsp. europaea plastid
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_015401 | (AG)6aattgtcaaaatggatagagtacctcttatgttatctac(T)12 | c | 4639 | 4701 | 63 | Design Primer |
| 2 | NC_015401 | (T)10c(A)10 | c | 9072 | 9092 | 21 | Design Primer |
| 3 | NC_015401 | (C)10(T)10c(A)12 | c | 17436 | 17468 | 33 | Design Primer |
| 4 | NC_015401 | (A)11ttttctcggttatgagacacattacaatttaatataagtccccaaaataaaatg(A)10 | c | 37949 | 38023 | 75 | Design Primer |
| 5 | NC_015401 | (GAAA)3tttc(T)13 | c | 63005 | 63033 | 29 | Design Primer |
| 6 | NC_015401 | (A)12gacg(A)10 | c | 80455 | 80480 | 26 | Design Primer |