Compound Compound Repeats of Fragaria vesca subsp. vesca chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_015206 | (C)10(A)10 | c | 4040 | 4059 | 20 | Design Primer |
| 2 | NC_015206 | (T)10attttatatataatatatatttttttttatgatat(A)10taataatattatctattatattat(TA)11 | c | 7029 | 7129 | 101 | Design Primer |
| 3 | NC_015206 | (T)10ctttatttag(A)11 | c | 15759 | 15789 | 31 | Design Primer |
| 4 | NC_015206 | (TA)6atacagatgcatgatacagcaagcatgccccttgttttgtaaagt(A)11 | c | 36556 | 36623 | 68 | Design Primer |
| 5 | NC_015206 | (T)10caagtgcggaaaccccaggaccagaagtagtaggatttattttcataataaaatatgtcgaaattttttgcgaaaatggctgaaatcaa(AAAT)3 | c | 55667 | 55777 | 111 | Design Primer |