Compound Compound Repeats of Gossypium thurberi chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_015204 | (T)10caattgaaaattccc(AAT)4 | c | 13537 | 13573 | 37 | Design Primer |
| 2 | NC_015204 | (C)13tttttttcctaatca(T)10 | c | 14687 | 14724 | 38 | Design Primer |
| 3 | NC_015204 | (T)11atttttattttaaggaattgcttagtcgtctagtaacaagtaagagtagtcgttagatatagat(A)10 | c | 69409 | 69493 | 85 | Design Primer |
| 4 | NC_015204 | (T)10cggaaaagttcaaaaatactatgatggctccgttgctttatatatttatttcgtctgtgattcagcaatcccaaagtttc(T)10 | c | 74633 | 74732 | 100 | Design Primer |