Compound Repeats of Anthriscus cerefolium chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_015113 | (CTATAT)3atcctataaaaagattctt(TA)7 | c | 9747 | 9797 | 51 | Design Primer |
| 2 | NC_015113 | (T)10c(A)13 | c | 16495 | 16518 | 24 | Design Primer |
| 3 | NC_015113 | (AAATA)3ggtcgaaattttttttgcgaaaatgatcgaattc(A)13 | c | 55413 | 55474 | 62 | Design Primer |