All Repeats of Berthellina sp. TLT-2006 mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_015091 | (AGTA)3 | p4 | 2116 | 2127 | 12 | Design Primer |
| 2 | NC_015091 | (CTG)7a(TAC)7cactactactacaactacttcaactaccgctactactgctg(CTA)4 | c | 3057 | 3152 | 96 | Design Primer |
| 3 | NC_015091 | (C)15 | p1 | 9714 | 9728 | 15 | Design Primer |