Compound Repeats of Rhizanthella gardneri plastid
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_014874 | (A)14gtatggtcaatttggtaacaattatactttgatagggatatttttttgaattatttagatatattg(AT)6tatatttatattatattgatattgcatacagtagactaacataatgtaaaatgaagatgtataatttc(TAAT)3 | c | 5100 | 5271 | 172 | Design Primer |
2 | NC_014874 | (T)11a(T)14 | c | 19142 | 19167 | 26 | Design Primer |
3 | NC_014874 | (A)12caatgtgttgattctagtactatttctttttttctttaatttttgtctactatatatgatatgtaatatgataatattccatatagataat(A)13 | c | 20710 | 20825 | 116 | Design Primer |