Compound Repeats of Cheilanthes lindheimeri chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_014592 | (T)10c(A)11 | c | 8137 | 8158 | 22 | Design Primer |
| 2 | NC_014592 | (ATA)4t(G)11 | c | 8900 | 8923 | 24 | Design Primer |
| 3 | NC_014592 | (G)14taatggtcgatatatacaattaa(T)10 | c | 13565 | 13611 | 47 | Design Primer |
| 4 | NC_014592 | (C)11ttcttttttttctctattcatatgttattattttctcgatattggtgaaaagacttgcctgtgagacattgtcaggccgtg(A)12 | c | 84474 | 84577 | 104 | Design Primer |
| 5 | NC_014592 | (T)12cacggcctgacaatgtctcacaggcaagtcttttcaccaatatcgagaaaataataacatatgaatagagaaaaaaaagaa(G)11 | c | 154253 | 154356 | 104 | Design Primer |