Compound Repeats of Cathaya argyrophylla chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_014589 | (T)15c(T)10 | c | 5668 | 5693 | 26 | Design Primer |
| 2 | NC_014589 | (TA)6(T)12 | c | 31752 | 31775 | 24 | Design Primer |
| 3 | NC_014589 | (A)11(G)15 | c | 58986 | 59011 | 26 | Design Primer |
| 4 | NC_014589 | (T)20caataaaatcctaatttattatcgtatccatcccatagcatctacgtcagtttcttctcttttctgctcttc(T)18 | c | 64710 | 64819 | 110 | Design Primer |
| 5 | NC_014589 | (A)10(T)16 | c | 100634 | 100659 | 26 | Design Primer |