Compound Compound Repeats of Citrullus lanatus mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_014043 | (T)10ctttg(A)11 | c | 33643 | 33668 | 26 | Design Primer |
| 2 | NC_014043 | (TCATTC)6tcattggtgagattgagagtttcttgctccttaatcgcggagcagcataccg(A)11 | c | 44228 | 44326 | 99 | Design Primer |
| 3 | NC_014043 | (A)12gaatgctgcttgatttgaacgaacattgtaagaacctttctaactgacaccccagtcataatgccacccacgtc(T)10 | c | 69809 | 69904 | 96 | Design Primer |
| 4 | NC_014043 | (AT)7taatatatattaccggctggctggtttttatgcaaaaaagacaaaacggaattggatttccactcat(AAGG)3 | c | 95822 | 95914 | 93 | Design Primer |
| 5 | NC_014043 | (AAGA)3tagttaaggttacgaagtcacttagtcgaactat(AAAG)3ggagtcccaggttacgaagtcaggtcagctggttaaggaaagctcaggttatgaaatcgcttagccg(TTAA)3 | c | 130607 | 130743 | 137 | Design Primer |
| 6 | NC_014043 | (T)11cggtatgctgctccgcgattaaggagcaagaaactctcaatctcacc(AATGAG)6 | c | 240137 | 240230 | 94 | Design Primer |