All Repeats of Oneirodes thompsoni mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_013871 | (C)10tatcccaaaaacctttatcttattcccccaaaaataccaggcccttccatgcaaacagggaaaaaattatgctaaacgggcaatagaagggtta(C)12 | c | 1700 | 1815 | 116 | Design Primer |
| 2 | NC_013871 | (C)12 | p1 | 1804 | 1815 | 12 | Design Primer |
| 3 | NC_013871 | (T)10(TTTTC)3* | c* | 16940 | 16960 | 21 | Design Primer |
| 4 | NC_013871 | (TTTTC)3 | p5 | 16946 | 16960 | 15 | Design Primer |