Compound Compound Repeats of Candida sojae mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_013839 | (ATATA)4tacacaggttagaacaatagtattaccgac(ATATG)8 | c | 6904 | 6993 | 90 | Design Primer |
| 2 | NC_013839 | (TAATA)5taacattcattataaatgacatgattaatcttttttatttcttttcattatgtctctttttcttttctttcaa(AAG)4 | c | 14747 | 14856 | 110 | Design Primer |
| 3 | NC_013839 | (ATCAT)8atgtcggtaatactattgttctaacctgtgta(TATAT)4 | c | 27927 | 28018 | 92 | Design Primer |
| 4 | NC_013839 | (TTTAT)3tatattctattctattttattttatt(CTATA)5 | c | 34233 | 34298 | 66 | Design Primer |
| 5 | NC_013839 | (AT)6aaattcctatagatattatatatgtaacttaaaatataataacttattaaccatgcgccgccccaccgaaggtggggcggcgtaaatagg(AAGATA)3 | c | 38888 | 39007 | 120 | Design Primer |