Compound Compound Repeats of Prumna arctica mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_013835 | (AAT)4attaattaaataattatattgtttatatcctattt(ATATA)3 | c | 15247 | 15308 | 62 | Design Primer |
2 | NC_013835 | (AAT)4attaattaaataattatattgtttatatcctattt(ATATA)3 | c | 15247 | 15308 | 62 | Design Primer |
3 | NC_013835 | (TAAA)3acttataatgatatatttaattaaatgtaatatattaaaataaattatttatattaaatacacaaaaatttaataacattttctctttcaactg(A)10 | c | 15418 | 15533 | 116 | Design Primer |