Compound Compound Repeats of Phaeoceros laevis mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_013765 | (CGT)4ctttaccagcgctgtagcctttacacaagcgccccactacggccgaaaatgcggtggctgccctatgactt(CTTC)3 | c | 61929 | 62023 | 95 | Design Primer |
| 2 | NC_013765 | (C)18tctat(CCG)4 | c | 92720 | 92754 | 35 | Design Primer |
| 3 | NC_013765 | (GGCG)3tccgct(G)12 | c | 179959 | 179988 | 30 | Design Primer |