Compound Compound Repeats of Olea europaea chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_013707 | (AG)6aattgtcaaaatggatagagtacctcttatgttatctac(T)11 | c | 4617 | 4678 | 62 | Design Primer |
2 | NC_013707 | (T)11c(A)10 | c | 9049 | 9070 | 22 | Design Primer |
3 | NC_013707 | (ATAA)3ag(A)12 | c | 9542 | 9567 | 26 | Design Primer |
4 | NC_013707 | (ATAA)3ag(A)12 | c | 9547 | 9572 | 26 | Design Primer |
5 | NC_013707 | (C)10(T)11c(A)12 | c | 17410 | 17443 | 34 | Design Primer |
6 | NC_013707 | (A)12ttttctcggttatgagacacattacaatttaatataagtccccaaaataaaatg(A)10 | c | 37922 | 37997 | 76 | Design Primer |
7 | NC_013707 | (GAAA)3tttc(T)13 | c | 62952 | 62980 | 29 | Design Primer |
8 | NC_013707 | (GAAA)3tttc(T)13 | c | 62978 | 63006 | 29 | Design Primer |