All Repeats of Thalassenchelys sp. Tht2 mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_013618 | (AACA)3 | p4 | 13531 | 13542 | 12 | Design Primer |
2 | NC_013618 | (AACA)3 | p4 | 13531 | 13542 | 12 | Design Primer |
3 | NC_013618 | (T)12aattccaaaaataaaaataccccccccctttaaccccccccttagccccaatttaaaaaaaa(C)25 | c | 15950 | 16048 | 99 | Design Primer |
4 | NC_013618 | (T)12aattccaaaaataaaaataccccccccctttaaccccccccttagccccaatttaaaaaaaa(C)25 | c | 15950 | 16048 | 99 | Design Primer |