All Repeats of Adelium sp. NCS-2009 mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_013554 | (ATCA)3 | p4 | 726 | 737 | 12 | Design Primer |
| 2 | NC_013554 | (CAAT)3 | p4 | 8492 | 8503 | 12 | Design Primer |
| 3 | NC_013554 | (AAT)4 | p3 | 13179 | 13190 | 12 | Design Primer |
| 4 | NC_013554 | (T)22cattaaaaattat(ATA)4ttaaatagaatatt(TA)6tgtatttaataatatagttaattatgactataattagatag(AT)6 | c | 15611 | 15736 | 126 | Design Primer |
| 5 | NC_013554 | (ATAA)3 | p4 | 15953 | 15964 | 12 | Design Primer |