Compound Compound Repeats of Pleurozia purpurea mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_013444 | (G)10ccgcgcgcg(C)14 | c | 5166 | 5198 | 33 | Design Primer |
| 2 | NC_013444 | (G)10ctt(G)10 | c | 25755 | 25777 | 23 | Design Primer |
| 3 | NC_013444 | (AT)6ttttttttgcctccgcgccgttgcggaggttcggagaagccaggttagtcaaatc(T)10 | c | 50292 | 50368 | 77 | Design Primer |
| 4 | NC_013444 | (AT)14gagtgatgtttactttctgtcagaagtgactc(AT)7 | c | 102238 | 102311 | 74 | Design Primer |
| 5 | NC_013444 | (TTCT)4tcttacttcacctaaaaggaaaggaaccttcttcttac(TTCT)3tcttataggcatttacatcaataataggacatcaataatagaataggagttgcctttactggtatt(CCTA)3tcct(AAAG)3 | c | 134133 | 134292 | 160 | Design Primer |