All Repeats of Ditaxis biseriata mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_013257 | (AT)6 | p2 | 5924 | 5935 | 12 | Design Primer |
| 2 | NC_013257 | (TAATA)3 | p5 | 6902 | 6916 | 15 | Design Primer |
| 3 | NC_013257 | (AAT)5 | p3 | 7416 | 7430 | 15 | Design Primer |
| 4 | NC_013257 | (AT)6 | p2 | 9708 | 9719 | 12 | Design Primer |
| 5 | NC_013257 | (TTTA)3 | p4 | 10175 | 10186 | 12 | Design Primer |
| 6 | NC_013257 | (ATT)4 | p3 | 10446 | 10457 | 12 | Design Primer |
| 7 | NC_013257 | (ATA)4 | p3 | 12200 | 12211 | 12 | Design Primer |
| 8 | NC_013257 | (TAAT)3 | p4 | 13115 | 13126 | 12 | Design Primer |
| 9 | NC_013257 | (TA)8attatatttattttatatacatatatgtaaatacttattatatataaatataat(TA)8attatatttaaataattatatta(AT)7(ATATA)3* | c* | 15937 | 16070 | 134 | Design Primer |