All Repeats of Sialis hamata mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_013256 | (TTTA)3 | p4 | 10054 | 10065 | 12 | Design Primer |
2 | NC_013256 | (TAAT)3 | p4 | 12615 | 12626 | 12 | Design Primer |
3 | NC_013256 | (AATA)3 | p4 | 14851 | 14862 | 12 | Design Primer |
4 | NC_013256 | (ATTTT)3aatatatatttatataatataaaaatttattttttatg(TA)6 | c | 15409 | 15473 | 65 | Design Primer |