Compound Compound Repeats of Macrogyrus oblongus mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_013249 | (T)17atatatataaatatttataattattataattatttttatataaaatcttttctatattattatctattaaatattatattaatta(AT)8 | c | 15743 | 15860 | 118 | Design Primer |
2 | NC_013249 | (TA)7ataaatttcatgatttatacataaataattattggtattgaatacataaaagtaaagcttaattaattaggaa(T)14caataagttttag(TTAT)3 | c | 16034 | 16159 | 126 | Design Primer |
3 | NC_013249 | (ATTT)3aatatgaatatatataaatatatttaaaataaattcatttattatttatataa(AT)6 | c | 16273 | 16349 | 77 | Design Primer |