Compound Compound Repeats of Selaginella moellendorffii plastid
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_013086 | (TA)10ttgatgaaggtccccggacggc(GGA)10 | c | 47022 | 47093 | 72 | Design Primer |
2 | NC_013086 | (TGC)6cgctgctgcccgccgccccttgtggg(CTGC)4 | c | 61517 | 61576 | 60 | Design Primer |
3 | NC_013086 | (TGAG)5tgataccttatcccagaacaccctacaccagctccagcgcatgtcgggagggtttgtttggtggcggtatctact(GCTGCC)3 | c | 63626 | 63738 | 113 | Design Primer |
4 | NC_013086 | (TTCC)12gactgggcggggtgagcacgaa(AGG)7catcatccgccatgggcagggcgttatgcatcaagcgactataattgaatgatggctgctggcggcgcatcggaatcaatatccatcgcggtaaa(TGCC)7 | c | 92590 | 92803 | 214 | Design Primer |
5 | NC_013086 | (AG)30cggatgacttcacgataatcacaagatttctgtcgaaatattgataggatgg(TGC)5 | c | 93488 | 93614 | 127 | Design Primer |
6 | NC_013086 | (CAG)5caccatcctatcaatatttcgacagaaatcttgtgattatcgtgaagtcatccg(CT)30 | c | 133836 | 133964 | 129 | Design Primer |
7 | NC_013086 | (AGGC)7atttaccgcgatggatattgattccgatgcgccgccagcagccatcattcaattatagtcgcttgatgcataacgccctgcccatggcggatgatg(CCT)7ttcgtgctcaccccgcccagtc(GGAA)12 | c | 134648 | 134862 | 215 | Design Primer |