Compound Compound Repeats of Metacrangonyx longipes mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_013032 | (AAT)4gagataaaacttatagaaaa(TAT)4 | c | 9006 | 9049 | 44 | Design Primer |
| 2 | NC_013032 | (A)15taaaaaatttcacctatataaatatttcatattcc(ATTA)3 | c | 13777 | 13838 | 62 | Design Primer |
| 3 | NC_013032 | (T)15(A)15 | c | 14038 | 14067 | 30 | Design Primer |