All Repeats of Parachlorella kessleri chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_012978 | (TAAA)3 | p4 | 19108 | 19119 | 12 | Design Primer |
| 2 | NC_012978 | (GAT)4 | p3 | 23834 | 23845 | 12 | Design Primer |
| 3 | NC_012978 | (AAAG)3 | p4 | 46140 | 46151 | 12 | Design Primer |
| 4 | NC_012978 | (A)12 | p1 | 53300 | 53311 | 12 | Design Primer |
| 5 | NC_012978 | (AAGAAC)3 | p6 | 62986 | 63003 | 18 | Design Primer |
| 6 | NC_012978 | (T)14 | p1 | 65941 | 65954 | 14 | Design Primer |
| 7 | NC_012978 | (ATTT)3 | p4 | 71358 | 71369 | 12 | Design Primer |
| 8 | NC_012978 | (A)12ttgtgatatacttttgtatgacaaaacatattgtttttgtaataatttcttttc(T)14 | c | 96321 | 96400 | 80 | Design Primer |
| 9 | NC_012978 | (GGAAA)3 | p5 | 98391 | 98405 | 15 | Design Primer |
| 10 | NC_012978 | (AATT)3 | p4 | 99300 | 99311 | 12 | Design Primer |
| 11 | NC_012978 | (AAC)4 | p3 | 109032 | 109043 | 12 | Design Primer |
| 12 | NC_012978 | (TTTCC)3 | p5 | 113887 | 113901 | 15 | Design Primer |
| 13 | NC_012978 | (A)14gaaaagaaattattacaaaaacaatatgttttgtcatacaaaagtatatcacaa(T)12 | c | 115892 | 115971 | 80 | Design Primer |