All Repeats of Chamaeleo dilepis mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_012436 | (AAT)4 | p3 | 3213 | 3224 | 12 | Design Primer |
| 2 | NC_012436 | (T)12 | p1 | 16874 | 16885 | 12 | Design Primer |
| 3 | NC_012436 | (AT)9taaaagataatatgcaagatgttgcatattatct(TA)10 | c | 17741 | 17812 | 72 | Design Primer |