Compound Compound Repeats of Keteleeria davidiana chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_011930 | (CTAT)3atagtgaatctactctat(ATAG)3 | c | 31782 | 31823 | 42 | Design Primer |
| 2 | NC_011930 | (AT)9aaatatgatttttccaatatcatcaataaaaag(A)12 | c | 74658 | 74720 | 63 | Design Primer |
| 3 | NC_011930 | (TATC)3tatatatatctatataggtagatatat(ATAG)3 | c | 76937 | 76987 | 51 | Design Primer |
| 4 | NC_011930 | (AT)6(TA)6 | c | 80014 | 80037 | 24 | Design Primer |