Compound Compound Repeats of Welwitschia mirabilis chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_010654 | (ATC)7ataatcatcatcataatcatcatcataatcatcatcataatcataatg(ATC)4 | c | 54253 | 54333 | 81 | Design Primer |
| 2 | NC_010654 | (ATC)14atgctct(ATC)9atgctct(ATC)5 | c | 57965 | 58062 | 98 | Design Primer |
| 3 | NC_010654 | (AAAGA)3actta(TCT)4 | c | 97938 | 97969 | 32 | Design Primer |