Compound Compound Repeats of Tilletia walkeri mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_010651 | (T)11catg(A)10 | c | 2010 | 2034 | 25 | Design Primer |
| 2 | NC_010651 | (A)11(T)10 | c | 19997 | 20017 | 21 | Design Primer |
| 3 | NC_010651 | (TAA)4ttactatttcatatactctctcttcctattaccttctctttttatatttatattttaaactttttttatatacaaaagaaaataggtagatgtttca(C)11 | c | 23629 | 23748 | 120 | Design Primer |