Compound Compound Repeats of Cryptomeria japonica chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_010548 | (A)12ggga(AT)9 | c | 3134 | 3167 | 34 | Design Primer |
2 | NC_010548 | (T)13agggttttataaaacgttttattcaaacgtttgttttgcgaaagaggtcctatttgctcgacggacatacctttgctgt(A)12 | c | 24099 | 24202 | 104 | Design Primer |
3 | NC_010548 | (TA)8atggtatttcattatacatttgattccttgaatcaaattccgcttctgat(A)12 | c | 28181 | 28258 | 78 | Design Primer |
4 | NC_010548 | (A)12gaatgaaatcccagtatgaaaagagtttatgcacgtagacatagatccatatgtatagatctatg(TCTA)3 | c | 36652 | 36740 | 89 | Design Primer |