All Compound Repeats of Sminthurus viridis mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_010536 | (ATAA)3 | p4 | 6788 | 6799 | 12 | Design Primer |
| 2 | NC_010536 | (AATA)3 | p4 | 7246 | 7257 | 12 | Design Primer |
| 3 | NC_010536 | (TAT)4 | p3 | 8222 | 8233 | 12 | Design Primer |
| 4 | NC_010536 | (TAAA)3 | p4 | 14246 | 14257 | 12 | Design Primer |
| 5 | NC_010536 | (AATA)3 | p4 | 14398 | 14409 | 12 | Design Primer |
| 6 | NC_010536 | (T)16aataataaatttattttaactaattatgaccctcgtttaaccacttatattgtattattaaatttgtctacatatata(ATTT)3ttattatttaatttatttatatgtataatataataaaatat(TA)9 | c | 14548 | 14712 | 165 | Design Primer |