All Repeats of Orchesella villosa mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_010534 | (AAATA)3 | p5 | 7184 | 7198 | 15 | Design Primer |
2 | NC_010534 | (TAAA)3 | p4 | 14252 | 14263 | 12 | Design Primer |
3 | NC_010534 | (AATA)3 | p4 | 14404 | 14415 | 12 | Design Primer |
4 | NC_010534 | (ATTT)3ttattatttaatttatttatatgtataatataataaaatattt(TA)8 | c | 14647 | 14717 | 71 | Design Primer |