Compound Compound Repeats of Oenothera biennis chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_010361 | (CCAT)3attgtacatatattaatatactccaacatattagaatatggatgggtagattagaatatggcaacatattatatgtcaacatattctaatctac(CCAT)3 | c | 6523 | 6640 | 118 | Design Primer |
2 | NC_010361 | (A)13gaaatattggttgt(A)14 | c | 85813 | 85853 | 41 | Design Primer |
3 | NC_010361 | (GAGGAA)7gaggatgagcttcac(GAGGAA)4 | c | 98027 | 98107 | 81 | Design Primer |
4 | NC_010361 | (TCCTCT)4tcctcgtgaagctca(TCCTCT)7 | c | 155660 | 155740 | 81 | Design Primer |