Compound Compound Repeats of Oenothera glazioviana chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_010360 | (CCAT)3attgtacatatattaatatactccaacatattagaatatggcaacatattctatgtcaacatattctaatctac(CCAT)3 | c | 6492 | 6589 | 98 | Design Primer |
| 2 | NC_010360 | (GAGGAA)8gaggatgagcttcac(GAGGAA)4 | c | 98934 | 99020 | 87 | Design Primer |
| 3 | NC_010360 | (TCCTCT)4tcctcgtgaagctca(TCCTCT)8 | c | 155792 | 155878 | 87 | Design Primer |