Compound Compound Repeats of Oenothera argillicola chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_010358 | (C)12(A)16 | c | 4106 | 4133 | 28 | Design Primer |
| 2 | NC_010358 | (T)12c(A)12 | c | 58180 | 58204 | 25 | Design Primer |
| 3 | NC_010358 | (A)15gaaatattggttgt(A)16 | c | 85351 | 85395 | 45 | Design Primer |
| 4 | NC_010358 | (GAGGAA)6gaggatgagcttcac(GAGGAA)5 | c | 97809 | 97889 | 81 | Design Primer |
| 5 | NC_010358 | (C)12(A)18ggatttgcgttttggttgaaattttgataattattaactaattcatcagcgagctgcttgagtttc(T)15 | c | 117739 | 117849 | 111 | Design Primer |
| 6 | NC_010358 | (TCCTCT)5tcctcgtgaagctca(TCCTCT)6 | c | 155673 | 155753 | 81 | Design Primer |