Compound Repeats of Cycas taitungensis mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_010303 | (TAGG)4ttaggtgcacctctcgcccatcgaagtgggaagtaatgaggctagt(C)11 | c | 178020 | 178092 | 73 | Design Primer |
| 2 | NC_010303 | (C)10ggcaatcacaccactctctgggtgggggaacagcaagggccgctccaatggaatataaccctccggacgggcattattctgcggcg(C)11 | c | 182412 | 182518 | 107 | Design Primer |
| 3 | NC_010303 | (G)10tgttaaccccttcttattcgaagggggt(G)10 | c | 341742 | 341789 | 48 | Design Primer |
| 4 | NC_010303 | (ATTC)4catttgagggagaggggaagaagccttttctccagcactcatctcatgatgagcatcgaaagaggagatattt(TGGA)3 | c | 356995 | 357095 | 101 | Design Primer |