All Repeats of Plakinastrella cf. onkodes DVL-2011 mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_010217 | (T)10ggctgaatatggtcatattatattgatgagtgcaatgataacaa(T)10 | c | 6032 | 6095 | 64 | Design Primer |
| 2 | NC_010217 | (T)10 | p1 | 11033 | 11042 | 10 | Design Primer |
| 3 | NC_010217 | (T)10 | p1 | 14837 | 14846 | 10 | Design Primer |
| 4 | NC_010217 | (T)10 | p1 | 15471 | 15480 | 10 | Design Primer |
| 5 | NC_010217 | (T)10 | p1 | 16691 | 16700 | 10 | Design Primer |