Compound Compound Repeats of Debaryomyces hansenii mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_010166 | (TTA)5actaatataatagg(ATT)4 | c | 5288 | 5328 | 41 | Design Primer |
| 2 | NC_010166 | (AT)6aaatatatataactaacctatttatagtatataactaggaatacctatcaatgaaaggtat(A)10 | c | 17801 | 17883 | 83 | Design Primer |
| 3 | NC_010166 | (AT)7tatatatattgctaacggtgaaatcttatataatttcttaaagtggaaatagttttatatt(TA)7 | c | 25115 | 25203 | 89 | Design Primer |